ID: 1076728898_1076728903

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1076728898 1076728903
Species Human (GRCh38) Human (GRCh38)
Location 10:132428665-132428687 10:132428689-132428711
Sequence CCGCCTTTGGAGAGGTAGGAGGG TCCAAGCGGACTTCGAGGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!