ID: 1076749809_1076749812

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1076749809 1076749812
Species Human (GRCh38) Human (GRCh38)
Location 10:132537141-132537163 10:132537162-132537184
Sequence CCGGGAAGCTGCACGGTCCACGC GCTCCGTCTGCGCGGAGAGCCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!