ID: 1076762351_1076762357

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1076762351 1076762357
Species Human (GRCh38) Human (GRCh38)
Location 10:132611846-132611868 10:132611861-132611883
Sequence CCCCGTCAGAGGAGGGTGTGGGA GTGTGGGAGGTGAAGTGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 31, 4: 171} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!