ID: 1076773024_1076773029

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1076773024 1076773029
Species Human (GRCh38) Human (GRCh38)
Location 10:132677347-132677369 10:132677394-132677416
Sequence CCATCTGGTCACTCATGTATCTC CAGAGGAAGGAGAAAGTGCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 71, 4: 678}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!