ID: 1076792720_1076792727

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1076792720 1076792727
Species Human (GRCh38) Human (GRCh38)
Location 10:132785614-132785636 10:132785643-132785665
Sequence CCCGGCAGCTCGGCCAGGGGCTT GCCGCGCGCCACAGCGGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 30, 4: 209} {0: 1, 1: 0, 2: 0, 3: 11, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!