ID: 1076793330_1076793349

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1076793330 1076793349
Species Human (GRCh38) Human (GRCh38)
Location 10:132787708-132787730 10:132787757-132787779
Sequence CCCCAAGGCGACGGCGCCCGCGC GCGGGAACTGCGGGGCCGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!