ID: 1076793332_1076793352

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1076793332 1076793352
Species Human (GRCh38) Human (GRCh38)
Location 10:132787710-132787732 10:132787762-132787784
Sequence CCAAGGCGACGGCGCCCGCGCCC AACTGCGGGGCCGGGGGGGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 106, 4: 1498}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!