ID: 1076793336_1076793360

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1076793336 1076793360
Species Human (GRCh38) Human (GRCh38)
Location 10:132787724-132787746 10:132787777-132787799
Sequence CCCGCGCCCAAGGCTCGGGCTCT GGGGGCGGGCAGGGGGAGTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 8, 3: 108, 4: 1027}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!