ID: 1076793337_1076793356

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1076793337 1076793356
Species Human (GRCh38) Human (GRCh38)
Location 10:132787725-132787747 10:132787769-132787791
Sequence CCGCGCCCAAGGCTCGGGCTCTG GGGCCGGGGGGGGCGGGCAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 38, 3: 436, 4: 3210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!