ID: 1076798082_1076798094

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1076798082 1076798094
Species Human (GRCh38) Human (GRCh38)
Location 10:132808486-132808508 10:132808533-132808555
Sequence CCAAGGGGAGGCCGCCCTTGTCC CAGCCCCGACGCAGACCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 144} {0: 1, 1: 0, 2: 0, 3: 9, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!