ID: 1076800144_1076800150

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1076800144 1076800150
Species Human (GRCh38) Human (GRCh38)
Location 10:132817964-132817986 10:132817992-132818014
Sequence CCAGGCTCCTTCTCCTGCTTCTC TGAGGGCTTTCTCATCACCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 167, 4: 1306} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!