ID: 1076802408_1076802423

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1076802408 1076802423
Species Human (GRCh38) Human (GRCh38)
Location 10:132836655-132836677 10:132836702-132836724
Sequence CCGGTGTCTGTCCGGCACCTTCT GTCCCAGGCCTCCCTGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 164} {0: 1, 1: 0, 2: 3, 3: 56, 4: 391}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!