ID: 1076816840_1076816852

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1076816840 1076816852
Species Human (GRCh38) Human (GRCh38)
Location 10:132919221-132919243 10:132919261-132919283
Sequence CCCATGGGTTGTCATTGCACGAA CCCAGAGGGCGGCCGTGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 60} {0: 1, 1: 0, 2: 2, 3: 28, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!