ID: 1076825414_1076825422

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1076825414 1076825422
Species Human (GRCh38) Human (GRCh38)
Location 10:132964831-132964853 10:132964856-132964878
Sequence CCAGCGGCTGCTGCGCCACCTCC CCTCCCACTGTGGCCAGGCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!