ID: 1076832687_1076832689

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1076832687 1076832689
Species Human (GRCh38) Human (GRCh38)
Location 10:133004577-133004599 10:133004595-133004617
Sequence CCTGTTTGGTGGTCTCTTCACAC CACACGGACGCGCATGAAAGAGG
Strand - +
Off-target summary No data {0: 4, 1: 12, 2: 14, 3: 18, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!