ID: 1076847921_1076847925

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1076847921 1076847925
Species Human (GRCh38) Human (GRCh38)
Location 10:133078829-133078851 10:133078845-133078867
Sequence CCCGCGGCGTGCGTGTGAGAAAC GAGAAACTGCCCCGCGGCGTGGG
Strand - +
Off-target summary {0: 4, 1: 21, 2: 12, 3: 14, 4: 22} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!