ID: 1076850941_1076850951

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1076850941 1076850951
Species Human (GRCh38) Human (GRCh38)
Location 10:133092710-133092732 10:133092744-133092766
Sequence CCAGGAAGAAGCACCTGAATGAA AGGGAGGGAGGAAGGAAGGAAGG
Strand - +
Off-target summary No data {0: 1209, 1: 4530, 2: 45311, 3: 45403, 4: 57468}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!