ID: 1076890114_1076890122

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1076890114 1076890122
Species Human (GRCh38) Human (GRCh38)
Location 10:133279217-133279239 10:133279235-133279257
Sequence CCTCCTGCCCTGGACCAGTTGGA TTGGAGCAGCAGCAGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 184} {0: 1, 1: 1, 2: 10, 3: 117, 4: 871}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!