ID: 1076895721_1076895734

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1076895721 1076895734
Species Human (GRCh38) Human (GRCh38)
Location 10:133310429-133310451 10:133310469-133310491
Sequence CCTGGCAACACAGCTACAGGTGG CTGCCGAAGGGAGGCTGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 203} {0: 1, 1: 0, 2: 3, 3: 40, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!