ID: 1076902661_1076902676

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1076902661 1076902676
Species Human (GRCh38) Human (GRCh38)
Location 10:133347604-133347626 10:133347656-133347678
Sequence CCTCTGTGGCCCCGAGTGCACTT ATCACCCAGGGACCCCCACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 103} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!