ID: 1076910858_1076910872

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1076910858 1076910872
Species Human (GRCh38) Human (GRCh38)
Location 10:133388652-133388674 10:133388704-133388726
Sequence CCTTGAGGGTCCCTGGCAGGGCC CTCTGCGAACTGCTGCCTGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!