ID: 1076922995_1076923003

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1076922995 1076923003
Species Human (GRCh38) Human (GRCh38)
Location 10:133465293-133465315 10:133465329-133465351
Sequence CCGGGCGCGTGGAGCTCTGGCAC GCACCGTGTGCGACGATGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 68} {0: 1, 1: 1, 2: 3, 3: 10, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!