ID: 1076936964_1076936966

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1076936964 1076936966
Species Human (GRCh38) Human (GRCh38)
Location 10:133572141-133572163 10:133572156-133572178
Sequence CCTGTGTGCTATTGTCCTTTCCC CCTTTCCCCCTTTTTCCTGCTGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 5, 3: 63, 4: 768}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!