ID: 1076936973_1076936980

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1076936973 1076936980
Species Human (GRCh38) Human (GRCh38)
Location 10:133572164-133572186 10:133572194-133572216
Sequence CCTTTTTCCTGCTGGGAGTGGGA CCGAGGGTGGCTCCTGACATCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 5, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!