ID: 1076936979_1076936994

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1076936979 1076936994
Species Human (GRCh38) Human (GRCh38)
Location 10:133572194-133572216 10:133572236-133572258
Sequence CCGAGGGTGGCTCCTGACATCGG TCAGCGGCTAGGCGGGTGGAGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 7, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!