ID: 1076937728_1076937739

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1076937728 1076937739
Species Human (GRCh38) Human (GRCh38)
Location 10:133577019-133577041 10:133577036-133577058
Sequence CCCAGCCTTCTACCACCCCTTCC CCTTCCTCACCGGTGCTCGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!