ID: 1076947449_1076947454

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1076947449 1076947454
Species Human (GRCh38) Human (GRCh38)
Location 10:133660832-133660854 10:133660885-133660907
Sequence CCCTCAACTCTCAGGTCACCATT GCAGTTAACCCTGCTGAAAGTGG
Strand - +
Off-target summary {0: 2, 1: 13, 2: 2, 3: 15, 4: 198} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!