|
Left Crispr |
Right Crispr |
| Crispr ID |
1076977007 |
1076977011 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:180901-180923
|
11:180917-180939
|
| Sequence |
CCAGCCAAATAAAATATATAGAT |
TATAGATAGCAGGCCAGGTGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 3, 2: 3, 3: 72, 4: 632} |
{0: 6, 1: 1, 2: 14, 3: 124, 4: 880} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|