|
Left Crispr |
Right Crispr |
| Crispr ID |
1076977852 |
1076977855 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:189138-189160
|
11:189154-189176
|
| Sequence |
CCAGACTAAATTGTGTATTCAGT |
ATTCAGTGGAAGGCTGATGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 41, 1: 63, 2: 47, 3: 40, 4: 372} |
{0: 7, 1: 31, 2: 67, 3: 71, 4: 234} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|