ID: 1076991799_1076991803

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1076991799 1076991803
Species Human (GRCh38) Human (GRCh38)
Location 11:279549-279571 11:279575-279597
Sequence CCTCAAGAGGGCGGACGCGCGCG TGGCGGCGCAGCTCCAGGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32} {0: 1, 1: 0, 2: 0, 3: 13, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!