ID: 1076992181_1076992189

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1076992181 1076992189
Species Human (GRCh38) Human (GRCh38)
Location 11:281219-281241 11:281259-281281
Sequence CCAGTTCATCGACCAGAGCTTCC CTGTCCTACCTGCTGGAGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70} {0: 1, 1: 0, 2: 0, 3: 26, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!