ID: 1077001106_1077001109

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1077001106 1077001109
Species Human (GRCh38) Human (GRCh38)
Location 11:322726-322748 11:322757-322779
Sequence CCAAAAACAAAGGAAAATTTGTT TCCCTGTGTTAAGGGAGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 94, 4: 938} {0: 1, 1: 4, 2: 24, 3: 48, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!