ID: 1077014921_1077014932

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1077014921 1077014932
Species Human (GRCh38) Human (GRCh38)
Location 11:395279-395301 11:395318-395340
Sequence CCTCCCAGAATGCCAGGGACCCA GGTCCACTTGGTGTTTAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 239} {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!