ID: 1077032586_1077032598

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1077032586 1077032598
Species Human (GRCh38) Human (GRCh38)
Location 11:476196-476218 11:476233-476255
Sequence CCCAGGGCCCTGTCTGCCCAGCC GGTCTTGCCTCCAAGGGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 73, 4: 569} {0: 1, 1: 0, 2: 0, 3: 5, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!