ID: 1077036648_1077036660

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1077036648 1077036660
Species Human (GRCh38) Human (GRCh38)
Location 11:498675-498697 11:498718-498740
Sequence CCTGAGATGAGCCCAGGGGCGGG CGCCGCCCGACCCTCCGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 206} {0: 1, 1: 0, 2: 1, 3: 3, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!