ID: 1077037500_1077037507

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1077037500 1077037507
Species Human (GRCh38) Human (GRCh38)
Location 11:502517-502539 11:502531-502553
Sequence CCCGGGAAGCCCCTGCCTCTCAT GCCTCTCATTTGCTTGGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 50, 4: 339} {0: 1, 1: 0, 2: 2, 3: 9, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!