ID: 1077043031_1077043049

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1077043031 1077043049
Species Human (GRCh38) Human (GRCh38)
Location 11:532938-532960 11:532988-533010
Sequence CCGCATCATGCTACAGCAGCCCC CCTGAACTCCAGGTCTGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 245} {0: 1, 1: 0, 2: 3, 3: 42, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!