ID: 1077043429_1077043435

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1077043429 1077043435
Species Human (GRCh38) Human (GRCh38)
Location 11:534447-534469 11:534471-534493
Sequence CCATCTGAAGGGCAAACCCACAG GGTCCCTGGGCCCCAACGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 170} {0: 1, 1: 0, 2: 0, 3: 36, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!