ID: 1077044748_1077044762

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1077044748 1077044762
Species Human (GRCh38) Human (GRCh38)
Location 11:539808-539830 11:539860-539882
Sequence CCTCAGAGGCCTGGGGAGGGGCT CTGTGGAGAAGGAGGGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 96, 4: 575} {0: 1, 1: 0, 2: 4, 3: 92, 4: 717}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!