ID: 1077056527_1077056537

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1077056527 1077056537
Species Human (GRCh38) Human (GRCh38)
Location 11:596694-596716 11:596742-596764
Sequence CCTCATCTAAGGACACCAATCCT CTGCTGTCACATTGGGGGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 66, 4: 306} {0: 1, 1: 0, 2: 28, 3: 189, 4: 877}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!