ID: 1077059518_1077059529

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1077059518 1077059529
Species Human (GRCh38) Human (GRCh38)
Location 11:611733-611755 11:611757-611779
Sequence CCAGAGGCCGGGGAGGAGCCGCC ACGCAGGGGGCCGAGGGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 428} {0: 1, 1: 0, 2: 4, 3: 41, 4: 513}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!