ID: 1077059553_1077059566

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1077059553 1077059566
Species Human (GRCh38) Human (GRCh38)
Location 11:611834-611856 11:611872-611894
Sequence CCATGCCCGGGGAGCTGTCGGGA GCCATGCCCGGGGAGCTGTCGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 8, 4: 119} {0: 2, 1: 1, 2: 1, 3: 15, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!