ID: 1077061388_1077061394

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1077061388 1077061394
Species Human (GRCh38) Human (GRCh38)
Location 11:619249-619271 11:619271-619293
Sequence CCACCGAAGGGGCTTATTTGGAG GAACCCTGGGGGCTCACCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 55} {0: 1, 1: 0, 2: 1, 3: 24, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!