ID: 1077065661_1077065668

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1077065661 1077065668
Species Human (GRCh38) Human (GRCh38)
Location 11:640027-640049 11:640041-640063
Sequence CCCGACTGTGCGCCCCCCGCGCC CCCCGCGCCCGGCCTTCCCCGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 0, 3: 11, 4: 145} {0: 1, 1: 1, 2: 6, 3: 95, 4: 686}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!