ID: 1077076373_1077076381

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1077076373 1077076381
Species Human (GRCh38) Human (GRCh38)
Location 11:704232-704254 11:704258-704280
Sequence CCTCGGGCCCTGGCTGCCGGGCG TCCGCTCGGTGGACTCCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 23, 4: 296} {0: 1, 1: 0, 2: 0, 3: 1, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!