ID: 1077080759_1077080769

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1077080759 1077080769
Species Human (GRCh38) Human (GRCh38)
Location 11:723767-723789 11:723797-723819
Sequence CCCAGCCCCACCTGTTTCCAAAG AGAACAAGCCTATGGCACTAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 29, 4: 454} {0: 1, 1: 0, 2: 1, 3: 11, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!