|
Left Crispr |
Right Crispr |
| Crispr ID |
1077091102 |
1077091109 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:778627-778649
|
11:778658-778680
|
| Sequence |
CCACTGGCCTCCGCCGGGCGCGG |
GCTTGTTATCCCAACACTTTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 4, 3: 19, 4: 184} |
{0: 5, 1: 721, 2: 28052, 3: 261445, 4: 274834} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|