ID: 1077094504_1077094513

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1077094504 1077094513
Species Human (GRCh38) Human (GRCh38)
Location 11:793581-793603 11:793620-793642
Sequence CCTTCTCGGGGGTGACGAGGGTC CTGTGGGGCAGGGGGTCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 1145} {0: 1, 1: 0, 2: 8, 3: 63, 4: 534}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!