ID: 1077103989_1077103999

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1077103989 1077103999
Species Human (GRCh38) Human (GRCh38)
Location 11:833953-833975 11:833989-834011
Sequence CCCTCCAGCTCCATTCCATGATG CTGTAGCTGCCGCTGTTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 80, 4: 1488} {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!