ID: 1077111609_1077111628

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1077111609 1077111628
Species Human (GRCh38) Human (GRCh38)
Location 11:864521-864543 11:864572-864594
Sequence CCTTGGCCGCAGGCCCAACTGCA GGAGCACTGTGGGCCCGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 160} {0: 1, 1: 0, 2: 4, 3: 31, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!